Наши телефоны: 8-(863)-290-00-45 8-(863)-303-08-65 8-903-406-70-27 8-928-279-81-86
Ветеринарная клиника Вита г. Ростов-на-Дону

Микробиологические и гистопатологические аспекты пиометры у собак

На сегодняшний день пиометра является одним из самых частых фатальных заболеваний собак, по причине смертности у сук стоит на втором месте после онкологических заболеваний.
Целью данного исследования было выяснить основные гистопатологические аспекты пиометры у собак и выяснить факторы патогенности E. Coli, выделенной из матки у собак больных пиометрой, выяснить возможные риски для человека, связанные с ешерихиозом.

В процессе работы были выявлены факторы патогенности различных штаммов E. Coli, выделенных от 100 собак с пиометрой.
Штаммы E. coli
были идентифицированы с использованием метода PCR. Кроме того, исследование включало подсчет колониеобразующих единиц, из материала выделенного от образцов внутриматочного содержимого, были проведены тесты на антибактериальную чувствительность изолированных штаммов E. coli и проведены гистологические исследования матки.

E. coli была самым распространенным микроорганизм выделенным от собак с пиометрой (76,6 %). В 42 % образцах маточной слизистой, пораженные воспалительным процессом участки занимали 39-56 %. Факторы патогенности E. Coli были идентифицированы в 98,0 % изученных штаммов, демонстрируя высокую частоту потенциально патогенных E. coli. Возможно, что собаки, живущие радом с человеком не одну тысячу лет являются важным фактором в передаче патогенных E. coli другим животным и человеку.



 

Карташов С.Н., Лобус С.В., Ключников А.Г.
Опубликовано в журнале «Ветеринарная патология»

ВВЕДЕНИЕ

Пиометра у собак (эндометрит-пиометра комплекс, железисто-кистозная гиперплазия – эндометрит — пиометра комплекс), болезнь взрослых собак, характеризующаяся воспалением слизистой матки с накоплением в ее полости гноя, как правило, развивающаяся в лютеальную фазу полового цикла (11). Большинство авторов связывают возникновение пиометры с гормональными изменениями при одновременном одновременном внутриматочном инфицировании (10,11).

Инцидентность пиометры у сук очень высока, она признана одной из главных причин заболевания и смерти этих животных.

Гиперплазия эндометрия вызывается прогестероном и, как правило, возникает перед развитием пиометры (10,11). Бактериальная инфекция — второе условие, необходимое для возникновения пиометры (11). Бактерии проникают через шейку в матку во время эструса (10).

При развитии кистозной гиперплазии эндометрия, матка не способно к самостерилизации после эструса, и бактерии легко выживают в кистозной жидкости измененного эндометрия. Наиболее часто встречающейся бактерией, заселяющей полость матки в период эструса является Escherichia coli (2). Некоторые штаммы E. coli является патогенным для человека и других видов животных, вызывая у людей тяжелые желудочно-кишечные расстройства и экстра-кишечные инфекции, например, инфекции мочевыделительного тракта, у детей E. coli может вызвать пневмонию (8).

Поскольку пиометру считают одной из главных болезней у сук, эта патология представляют потенциальный риск для здоровья людей, поскольку выделения из матки могут быть источником инфекции для человека. Целью этого исследования явилось оценить микробиологические и гистопатологические аспекты пиометры у собак. Провести идентификацию генов ответственных за факторы патогенности E.coli, выяснить возможные риски для здоровья человека со стороны суки больной пиометрой.

Материалы и методы 

Объект исследования. В ветеринарной клинике Вита г. Шахты, г. Таганрог Ростовской области были происследованы 100 животных больных пиометрой. Возраст исследованных животных колебался от 2 до 16 лет.

Из истории болезни стало известно, что 11 животным применялись препараты прогестерона с целью контроля рождаемости. У одиннадцати сук была история. Шестьдесят четыре процента сук к моменту заболевания не разу не щенились, 21 % щенились только один раз и 14 % щенились неоднократно.

Микробиологические исследования. Стерильным способом были отобраны по 5, мл внутриматочной жидкости от каждой исследованной суки. Внутиматочное содержимое отбиралось из каждого рога матки в момент овариогистерэктомии. Полученные образцы были культивированы в аэробных условиях на кровяном агаре при 37ºC в течение 24-96 часов. Образцы были также культивированы в аэробных условиях на среде Китт-Тарцци при 37ºC в течение 24 часов.

Исследование факторов патогенности изолированных шатоммов E. coli. Исследование факторов патогенности выделенных штаммов E. coli проводили методом выявления соответствующих генов методом ПЦР.

Таблица 1

Праймеры использованные для определения различных генов методом ПЦР, размер ампликона

Ген

праймер

олигонуклеотидная пара (5´→3´)

размер

источник

LT LTA-1
LTA-2
GGCGACAGATTATACCGTGC
CCGAATTCTGTTATATATGTC
696 Schultsz
et al., 1994
STa STI-1
STI-2
TTAATAGCACCCGGTACAAGCAGG
CTTGACTCTTCAAAAGAGAAAATTAC
147 Olsvik et al., 1993
STb STb-1
STb-2
ATCGCATTTCTTCTTGCATC
GGGCGCCAAAGCATGCTCC
172 Blanco et al., 1997
VT1 VT1-A
VT1-B
GAAGAGTCCGTGGGATTACG
AGCGATGCAGCTATTAATAA
130 Pollard et al., 1990
VT2 VT2-3
VT2-5
CCGTCAGGACTGTCTGAAAC
GAGTCTGACAGGCAACTGTC
726 Woodward et al., 1992
pap pap-1
pap-2
GCAACAGCAACGCTGGTTGCATCAT
AGAGAGAGCCACTCTTATACGGACA
336 Yamamoto et al., 1995
hly hly-1
hly-2
AACAAGGATAAGCACTGTTCTGGCT
ACCATATAAGCGGTCATTCCCGTCA
1177 Yamamoto et al. 1995
iuc iuc-1
iuc-2
TACCGGATTGTCATATGCAGACCGT
AATATCTTCCTCCAGTCCGGAGAAG
602 Yamamoto et al.,1995
cnf cnf1
cnf2
AAGATGGAGTTTCCTATGCAGGAG
CATTCAGAGTCCTGCCCTCATTATT
498 Yamamoto et al., 1995
sfa sfa-1
sfa-2
CTCCGGAGAACTGGGTGCATCTTAC
CGGAGGAGTAATTACAAACCTGGCA
410 Yamamoto et al., 1995
afa afa-1
afa-2
GCTGGGCAGCAAACTGATAACCTC
CATCAAGCTGTTTGTTCGTCCGCCG
750 Yamamoto et al., 1995

Для этого использовались наборы праймеров к сиквенсам соответствующих генов. Так использовались праймеры сиквинсов генов: ассоциированного с пиелонефритом (pap), гемолизина (hly), аэробактина (iuc), цитотоксин-некротизирующего фактора(cnf1), S фимбрия (sfa), афимбиральный адгезин I (afa), теплолабильный (LT) и теплостабильные факторы (STa и STb), энтеротоксин и веротоксин (VT). Размеры ампликонов и источники структуры указаны в таблице 1.

Антибактериальная восприимчивость выделенных штаммов E. coli. Образцы микроорганизмов полученные из маточного содержимого были проверены на чувствительно к антибактериальным препаратам.

При этом использовались следующие диски: хлорамфеникол (30 μg), тетрациклин (30 μg), аксациллин (1 μg), пенициллин (10 U.I)., цефалотин (30 μg), линкомицин (2 μg), гентамицин (10 μg), ванкомицин (30 μg), эритомицин (15 μg), сульфазотрин (25 μg), ампициллин (10 μg), цефацетрил (30 μg), энрофлоксацин (5 μg), порфлоксацин (30 μg), цефалексин (30 μg), полимиксин B (300 μg), тобрамицин (10 μg), амоксициклин (10 μg), цефокситин (30 μg), клиндамицин (2 μg), неомицин (30 μg) и амикацин (30 μg).

Все культуры были классифицированы как чувствительные, слабо чувстительные и нечувствительные. Классификация велась в соответствии с диаметра зоны задержки роста на среде и концентрации препарата в соответствии с инструкцией производителя теста.

Гистологические исследования. 

Образцы тканей матки были отобраны в 10%-й формальдегид и последующем после стандартной проводки и приготовления микросрезов окрашены гемотоксилином и эозином, после чего исследовались под микроскопом.

Чтобы оценить интенсивность воспалительного ответ, велся подсчет участков инфильтрации стенки матки клетками воспаления. Каждое поле было разделено на 10 участков, что помогало выразить в процентах участок воспалительного инфильтрата.

10 участков препарата были исследованы в каждом фрагменте, интенсивность воспалительного ответа оценивался по выраженности инфильтрата по 5 бальной шкале от 0-4.

Таблица 2

Оценка выраженности воспалительного ответа в исследованном образце с стенки матки

Оценка в баллах

выраженность инфильтрата в 10 полях зрения в зависимости от его распространения в каждом поле (в процентах)

0

<20

1

20 — 38

2

39 — 56

3

57 — 75

4

> 75

Результаты исследования

Микробиологические исследования

Из 200 образцов внутриматочной жидкости полученных от 100 сук, больных пиометрой в 197 образцах (98,5 %) получен рост микроорганизмов при посеве на питательные среды. Три стерильные образца были получены от сук из одного рога матки, тогда как в другом роге матки отмечался рост бактерий.

При этом были изолированы следующие бактерии: E.coli изолирована из 146 образцов (74.1 %), Klebsiella pneumoniae subsp.pneumoniaeизолирована из 6 образцов (3 %), Citrobacterdiversusизолирован из 6 образцов (3 %), Pseudomonas aeruginosa изолирован из 4 образцов (2 %), Staphylococcus kloosii изолирован из 4 образцов (2 %), Сальмонелла spp. изолирована из 4 образцов (2 %), изолирован из 4 образцов Proteus mirabilis (2 %), Streptococcus sp. из 2 образцов (1 %), Morganella morgani из 2 образцов (1 %), Klebsiella pneumoniae subsp. azanae из 2 образцов (1 %), Staphylococcusschleiferisubsp. coagulansиз 2 образцов (1 %), Staphylococcusintermediusиз 2 образцов (1 %), Staphylococcusepidermidisиз 2 образцов (1 %), Streptococcuscanisиз 2 образцов (1 %), Corynebacterium jeikeium из 2 образцов(1 %) внутриматочной жидкости. Ассоциации возбудителей отмечались в пяти образцах, что составило 2,5 %.

Это были следующие ассоциации: E.coli и Staphylococcus kloosii получены из внутриматочной жидкости двух рогов матки; E.coli и Enterococcus faecium получены из внутриматочной жидкости двух рогов матки, E. coli и Streptococcus spp получены из внутриматочной жидкости одного рога матки и E. coli от второго рога матки этого же животного. Частота изоляции E. coli (76,6 %) были статистически выше (P <0.05) при сравнении с другими микроорганизмы, кроме того инфекция матки вызванная E. coli возникала как моноинфекция, так и в ассоциации с другими бактериями.

Исследование факторов патогенности полученных штаммов E. coli

Из 151 изолированных штаммов E.coli, 120 (79,5 %) оказались положительными на ген sfa, 87 (57,6 %) были положительны на ген pap, 86 (56,9 %) были положительны на ген cnf, 52 (34,4 %) были положительны на ген hly, 51 (33,8 %) были положительны на ген iuc и 5 (3,3 %) были положительны на ген afa. Ни один из образцов не был положительным на гены LT1, LT2, Sta, STb, VT1 и VT2. Из полученных 151 изолятов, 3 (2,0 %) не были положительны ни на один из факторов патогенности учитываемых в данном исследовании.

Антибактериальная восприимчивость изолирования 

Рассматривая 151 изолят E. coli, 86,1 % были стойкими к цефалотину, 68,9 % к ампициллину, 46,4 % к цефокситину, 34,4 % к тобрамицину, 32,5 % к тетрациклину, 29,8 % к амикацину, 27,8 % к цефалексину, 15,2 % к гентамицину, 13,9 % к цефотаксиму, 13,2 % к сульфазотрину, 12,6 % к энрофлоксоцину, 10,6 % к азтреонаму, 7,9 % к хлорамфениколу, 6 % к неомицину, 2 % к норфлоксацину и 0,7 % к полимиксину B.

Самая высокая чувствительность была к норфлоксацину (94%), полимиксину в (82,8 %), сульфазотрину (76,8 %), энрофлоксацину (75,5 %) и хлорамфеникол (75,5 %).
Подсчет колоний микроорганизмов, формирующих колониеобразующие единицы в образцах из внутриматочного содержимого у сук с пометрой показан в таблице 3.

Таблица 3

Результаты подсчета количества бактерий в единице объема образцов внутриматочного содержания сук с пиометрой.

Изолированный микроорганизм (МО)

Количество образцов из которых был изолирован МО

Среднее число КОЕ в образце

Максимальное – минимальное количество КОЕ в образце

Escherichia coli

151

7,600,000

300 — 13,700,000,000

Klebsiella pneumoniae subsp. pneumoniae

6

13,450,000

695,000 — 15,600,000

Citrobacter diversus

6

11,950,000

500,000 — 99,000,000

Staphylococcus kloosii

6

1,140,500

225,000 — 11,200,000

Streptococcus spp.

5

18,500,000

16,200,000 — 104,000,000

Pseudomonas aeruginosa

4

907,500

80,000 — 1,440,000

Salmonella spp.

4

12,100,000

10,000,000- 18,900,000

Proteus mirabilis

4

850,350

600 — 1,790,000

Morganella morgani

2

1,450

1,300 — 1,600

Klebsiella pneumoniae subsp. azanae

2

862,500

685,000 — 1,040,000

Staphylococcus schleiferi subsp. coagulans

2

36,100,000

9,700,000 — 62,500,000

Staphylococcus intermedius

2

1,308,000,000

266,000,000 — 2,350,000,000

Staphylococcus epidermidis

2

1,185,000

1,060,000 — 1,310,000

Streptococcus canis

2

624,000

138,000 — 1,110,000

Corynebacterium jeikeium

2

10,000

5,000 — 15,000

Enterococcus faecium

2

440,000

405,000 — 475,000

Гистопатологические исследования

Результаты гистопатологических исследований образцов маточных стенок у сук с пиометрой, показан в таблице 4. В 42 % образцов, из которых были выделены микроорганизмы, распространение очагов воспаления в маточной стенке составило от 39 до 56 %.

Распространение воспалительных инфильтратов в образцах стенки матки от животных у которых была выделена E. coli не отличалось от этого показателя при выделении других микроорганизмов. Однако, было замечено что образцы в которых при микробиологическом исследовании выделялось больше КОЕ (было большее количество бактерий), формировали и большую инфильтрацию стенки матки воспалительными клетками.

Таблица 4

Результаты гистопатологических исследований образцов маточных стенок полученных от сук с пиометрой, оценка воспалительного ответа в соответсвие с выделенным возбудителем

Микроорганизм (МО)

количество образцов из которых МО был выделен

оценка в баллах, %

0

1

2

3

4

E.coli

146

6,2

21,2

41,1

24,7

6,8

Грамм «–» бактерии отличные от E.coli

28

0

21,4

50,0

25,0

3,6

Грамм «+» бактерии

18

0

44,4

44,4

5,6

5,6

Ассоциация E.coli и грамм «+» бактерий

5

0

40,0

40,0

20,0

0

Отсутствие МО

3

33,3

0

33,3

0

33,3

Обсуждение полученных результатов

Fransson и др. (9) изолировали E.coli у90% сук с пиометрой. В этом исследовании E.coli была выделена от 76,6 % образцов внутриматочной жидкости полученной от сук с пиометрой. Количество образцов, из которых была выделена E.coli, статистически больше, чем количество образцов из которых были выделены другие агенты (P <0,05).

Похожие данные получены и Fransson и др. (9), а также Oluoch и др. (18), они изучили 674 образца E. coli изолированных при различных типах инфекций у собак, включая инфекции мочеполового тракта и наблюдали в 90 % чувствительность этих микроорганизмов к норфлоксацину, в 87,5 % к энрофлоксоцину, в 90,7 % к гентамицину и в 85,9 % к амикацину. Выделенные нами 151 изолят E. coli имели высокую устойчивость к цефалотину (86,1 %) и ампициллину (68, 9 %), а самая высокая чувствительность была к норфлоксацину (94 %), а также к энрофлоксацину, гентамицину и амикацину, процент чувствительных штаммов составил соответственно, 75,5 %; 70,2 %; и 55,6 %.

Уропатогенные E. coli (UPEC) вызывают поражения мочевых путей и почек у человека и других видов животных. Бактерии перемещаются из желудочно-кишечного трактат в мочевые пути. Большинство инфекций мочевого тракте начинается с колонизации штаммами E. coli, способными к размножению в мочевом тракте (22).

P pili является самым важным адгезином в штаммах E. coli, вызывающих поражение почек. Ген ответственный за функции этого адгезина называют pap (pyelonephriti associated pili) (22). Johnson и др.(13) проанализировали 63 образца фекалий собак и в 30 % выделили E. coli, из ниху56 % штаммов наблюдался ген pap. На основании этих данных они заключили, что ExPEC (extra-intestinal pathogenic E. coli) постоянно присутствует в собачьих фекалиях и может быть источником ExPEC для людей.

В нашем исследовании 57,6 % изолированных E.coli были положительными на ген pap, таким образом данные полученные нами очень похожи на данные полученные Johnson и др. (13) при исследовании фекалий здоровых собак. Такая схожесть полученных результатов предполагает, что E. coli выделенные из образцов внутриматочной жидкости от собак с пиометрой, попали в матку из кишечника той же самой собаки.

S fimbria S (sfa) является также важным ассоциированным с болезнями почек у людей и животных адгезином (22). В данном исследовании, 79,5 % выделенных штаммов E. coli были положительными на sfa, что по видимому указывает на то, что у данного адгезина выжная роль в колонизации матки больных собак.

У уропатогеных штаммов E. coli, также находят еще один адгезин — afimbrial (afaI и afaIII) (22). В нашем исследовании только в 3,3 % образцов была изолирована E. coli положительная на ген afa. По всей видимости данный адгезин не играет большую роль в колонизации матки у больных пиометрой собак.

Некоторые уропатогенные E.coli производят экзотоксин первоначально названный гемолизин (ответственный за его синтез ген имеет название hly), ген), поскольку был способен разрушать эритроциты и другие клетки с развитием воспалительной реакции (17,22). Многочисленные исследования уже доказали то, что гемолизин способны выделять штамы Escherichia coli, вызывающие экстра-кишечные инфекции у люди (12). У многих штаммов E. coli изолированных от собак и кошек с инфекциями мочевых путей имеется hly (25).

Low et al. (16) сравнивая гены pap и hly штаммов E. coli выделенных от собак и людей с инфекциями мочеполового тракта показали, что все изолированные штаммы имели идентичную структуру этих генов. Эти данные показывают, что некоторые штаммы E.coli способны инфицировать как собак, так и людей.

В этом исследовании 34,4 % образцов E. coli изолированных от собак больных пиометрой были положительными на ген hly. Этот показатель ниже, чем тот что наблюдается при выделении E. coli от людей с урологическими проблемами, что показывает на меньшую роль данного фактора патогенности в развитии пиометры, чем патологии уринального тракта.

Цитостатический некротизирующий фактор (cnf) был описан в последние годы, при выделении штаммов E. coli от людей с различными патологиями и рассматривается как важный фактор патогенности данного микроорганизма(27). На сегодняшний день описаны два типа цитостатического некротизирующего факторы, cnf1 и cnf2. Синтез cnf1 связано с продукцией a-гемолизина, E. coli производящий cnf1 были изолированы как от собак больных кишечными и внекишечными инфекциями, от и из кала здоровых собак (20). В этом исследовании cnf был обнаружен у большого количества штаммов (56,9 %), такие же данные наблюдали Pohl et al. (20), Wray и Woodward (27) and Beutin (2).

Мы знаем и другие факторы патогенности уропатогенных штаммов E. coli, такие, например, как способность захватывать железо. У этих E. coli имеется много механизмов захвата железа (22). Аэробактин (ответственны ген iuc), эффективная хелатная система захвата железа интестинальными бактериями (6).

В этом исследовании 33,8 % штаммов E. coli извнутриматочного содержимого были положительны на ген iuc. Похожие данные наблюдали De Lorenzo и Martinez (6), но в фекалиях здоровых собак. Это снова доказывает, что источником E. coli вызывающей пиометру у собака является микрофлора кишечника самой больной собаки.

Von Sydow и др. (24) в 89,21 % выделили из кала здоровых собак E.coli, у 76 % выделенных штаммов отмечались различные факторы патогенности. Наиболее частыми факторами патогенности были iuc (48%), sfa (40 %) и pap(24 %), и 57,14 % выделенных штаммов были положительны больше чем одному фактор ядовитости. В этом исследовании были идентифицированы фактору патогенности.

В нашем исследовании 98,0 % выделенных штаммов Escherichia coli имели факторы патогенности E. coli (P <0.05), наиболее часто встречались такие факторы патогенности как sfa (79,5 %), pap (57,6 %) и cnf (56,9 %), а 80,4 % выделенных штаммов были положительны больше чем по одному фактор патогенности. Эти показатели отличаются от тех, что получил Von Sydow и др. (24) при выделении E. coli из фекалий здоровых собак, это предполагает, что эти факторы имеют большее значение в колонизации матки у собак при развитии пиометры.

В нашем исследовании ни один из штаммов E. coli не был положителен на такие факторы патогенности как LT, Sta, STb, VT1 и токсины VT2, что доказывают их меньшую роль при колонизации матки у собак и развитии пиометры.

Таким образом факторы патогенности были идентифицированы у 98,0 % штаммов, выделенных от собак больных пиометрой, что говорит о высокой потенциальной патогенности штаммов E. coli, вызывающих пиометру у собак, и важный источник собак в инфицировании E. coli человека и других видов животных.

Литература

1. Bauer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. (1966). Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol., 45, 493-496.
2. Beutin, L. (1999): Escherichia coli as a pathogen in dogs and cats. Vet. Res., 30, 285-298.
3. Blanco, M.; Blanco, J.E.; Gonzalez, E.A.; Mora, A.; Jansen, W.; Gomes, T.A.T.; Zerbini, F.; Yano, T.; Pestana de Castro, A.F.; Blanco, G. (1997). Genes coding for enterotoxins and verotoxins in porcine Escherichia coli strains belonging to different O:K:H serotypes: relationship with toxic phenotypes. J. Clin. Microbiol., 35, 2958- 2963.
4. Boom, R.; Sol, C.J.A.; Salimans, M.M.M.; Jansen, C.L.; Wertheim-Van Dillen, P.M.E.; Van Der Noordaa, J. (1990). Rapid and simplemethod for purification of nucleic acids. J. Clin. Microbiol., 28, 495-503.
5. Clinical and Laboratory Standards Institute (CLSI). 2003. Performance standards for antimicrobial disk susceptibility tests; approved standard — 8 edn. NCCLS document M2-A8, Pennsylvania.
6. De Lorenzo, V.; Martinez, J.L. (1988). Aerobactin production as a virulence factor: a reavaluation. Eur. J. Clin. Microbiol. Infect. Dis., 7, 621-629.
7. Dhaliwal, G.K.; Wray, C.; Noakes, D.E (1998). Uterine bacterial flora and uterine lesions in bitches with cystic endometrial hyperplasia (pyometra). Vet. Rec., 143, 659-661.
8. Franco, B.D.G.M.; Landgraf, M. (1996). Microrganismos patogênicos de importância em alimentos. In: Franco B.D.G.M., Landgraf, M. (eds.). Microbiologia dos Alimentos. Atheneu, São Paulo, pp. 33-81.
9. Fransson, B.; Lagerstedt, A.S.; Hellmen, E.; Jonsson, P. (1997). Bacteriological findings, blood chemistry profile and plasma endotoxin levels in bitches with pyometra or other uterine disease. J. Vet. Med., 44, 417-426.
10. Grooters, A.M. (1994). Diseases of the ovaries and uterus. In: Birchard, S.J., Sherding, R.G. (eds.), Saunders Manual of Small Animal Practice, 3rd. edn. W.B. Saunders Company, Ohio, pp. 613-632.
11. Hidalgo, C.G.; Cohen, A.S.; Méndez, J.V. (1986). Reproducción de Animales Domésticos. Editorial Limusa, Balderas.
12. Hughes, C.; Hacker, J.; Roberts, A.; Goebel, W. (1983). Hemolysin production as a virulence marker in symptomatic and asymptomatic urinary infections caused by Escherichia coli. Infec. Immun., 39, 546-551.
13. Johnson, J.R.; Stell, A.L.; Delavari, P. (2001). Canine feces as a reservoir of extraintestinal pathogenic Escherichia coli. Infec. Immun., 69, 1306-13
14. Krieg, N.R.; Holt, J.C. (1994). Bergey’s Manual of Sistematic Bacteriology, 9th edn. Williams & Wilkins, Baltimore, 984 p.
15. Lennette, E.H.; Balows, A.; Hansler, W.J.; Shadomy, H.J. (1985). Manual of Clinical Microbiology. American Society for Microbiology Press, Washington.
16. Low, D.A.; Braaten, B.A.; Ling, G.V.; Johnson, D.L.; Ruby, A.L. (1988). Isolation and comparison of Escherichia coli strains from canine and human patients with urinary tract infections. Infec. Immun., 56, 2601-2609.
17. Murray, P.R.; Baron, E.J.; Pfaller, M.A.; Tenover, F.C.; Yolken, R.H. (1999). Manual of Clinical Microbiology, 7th edn. American Society for Microbiology, Washington.
18. Oluoch, A.O.; Kim, C.; Weisiger, R.M.; Koo, H.Y.; Siegel, A.M.; Campbell, K.L.; Burke, T.J.; Mckiernan, B.C.; Kakoma, I. (2001). Nonenteric Escherichia coli isolates from dogs: 674 cases (1990- 1998). J. Am. Vet. Med. Ass., 218, 381-384.
19. Olsvik, O.; Strockbine, N.A. (1993). PCR detection of heat-stable, heat-labile, and Shiga like toxin genes in Escherichia coli. In: Persing, D.H., Smith, T.F., Tenover, F.C., White, T.J. (eds.). Diagnostic Molecular Microbiology: Principles and Applications. American Society for Microbiology, Washington, p. 271-276.
20. Pohl, P.; Oswald, E.; Van Muylem, K. (1993). Escherichia coli producing CNF1 and CNF2 cytotoxins in animals with different disorders. Vet. Res., 24, 305-311.
21. Pollard, D.R.; Johnson, W.M.; Lior, H.; Tyler, S.D.; Rozes, K.R. (1990). Rapid and specific detection of verotoxin genes in Escherichia coli by the polymerase chain reaction. J. Clin. Microbiol., 28, 540-545.
22. Saylers, A.A.; Whitt, D.D. (2002). Bacterial Pathogenesis: A Molecular Approach. ASM Press, Washington.
23. Schultsz, C.; Pool, G.J.; Van Ketel, R.; Wever, D.; Speelman, P.; Dankert, J. (1994). Detection of enterotoxigenic Escherichia coli in stool samples by using non-radioactively labeled oligonucleotide DNA probes and PCR. J. Clin. Microbiol., 32, 2393-2397.
24. Von Sydow, A.C.M.D.G.; Coogan, J.A.; Moreno, A.M.; Melville, P.A.; Benites, N.R. (2006): Ocorrência de fatores de virulência em estirpes de Escherichia coli isoladas de fezes de cães errantes. Arq. Inst. Biol., 73, 401-407.
25. Wilson, R.A.; Keefe, T.J.; Davis, M.A.; Browing, M.T.; Ondrusek, K. (1988). Strains of Escherichia coli associated with urogenital disease in dogs and cats. Am. J. Vet. Res., 49, 743-746.
26. Woodward, M.J.; Carroll, P.J.; Wray, C. (1992). Detection of entero and verocyto-toxin genes in Escherichia coli from diarrhea disease in animals using polymerase chain reaction. Vet. Microbiol., 31, 251-261.
27. Wray, C.; Woodward, M.J. (1997). Escherichia coli infections in farm animals. In: Sussman, M. (ed.). Escherichia coli: Mechanisms of Virulence. Cambridge University Press, United Kingdom, p. 49-84.
28. Yamamoto, S.; Kurazono, H.; Takeda, Y.; Yoshida, O. (1995). Detection of urovirulence factors in Escherichia coli by multiplex polymerase chain reaction. FEMS Immun. Med. Microbiol., 12, 85-90.

SUMMARY

E. coli was the most widespread a microorganism allocated from dogs with pyometra (76,6 %). 120 strains E. coli (79,5 %) were positive on a gene sfa, 86 (56,9 %) were positive on a gene cnf, 87 (57,6 %) were positive on a gene pap, 52 (34, 4 %) were positive for hly, 51 (33,8 %) were positive for iuc and 5 (3,3 %) were positive for afa genes. One observed more sensitivity of E. coli to norfloxacin, polimixin B, sulphazotrin, chloranfenicol and enrofloxacin. In 42% of the samples of uterine walls where microorganisms were isolated, the sizes of the areas of the inflammatory responses corresponded to 39-56%. Factors of pathogenicity E. Coli have been identified in 98,0 % studied strains, showing high frequency potentially pathogenic E. coli. Probably, that the dogs, living glad with the man not one thousand years are the important factor in transfer pathogenic E. coli to other animals and the man.

Key-words: Escherichia coli, histopathological, microbiological, female, dog, pyometra.

    Наши представительства

    Контакты

    г. Ростов-на-Дону
    ул. Мадояна, 198/125
    тел.: (863) 29-000-45
    303-08-65,
    8-903-406-70-27,
    8-928-279-81-86
    Режим работы:
    Круглосуточно
    Яндекс.Метрика
    X